ID: 931624563_931624568

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 931624563 931624568
Species Human (GRCh38) Human (GRCh38)
Location 2:64245189-64245211 2:64245216-64245238
Sequence CCAACTTCCCTTCAGTCCCACAT CTTTTTCATTCTTTTCCTTCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 15, 3: 229, 4: 1408}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!