ID: 931633625_931633635

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 931633625 931633635
Species Human (GRCh38) Human (GRCh38)
Location 2:64322808-64322830 2:64322854-64322876
Sequence CCCCTGAGGGAGCTTCCTGGGAA TCTCAGGAGGGCTCAGGAATAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!