ID: 931694986_931694996

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 931694986 931694996
Species Human (GRCh38) Human (GRCh38)
Location 2:64864986-64865008 2:64865005-64865027
Sequence CCCCCAGGACCCCACCCCGGAGA GAGACCTCCCAGCAGTCAAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 45, 4: 319} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!