ID: 931748551_931748562

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 931748551 931748562
Species Human (GRCh38) Human (GRCh38)
Location 2:65311534-65311556 2:65311556-65311578
Sequence CCCTAGAGAAAGACCCCAAGGAA AGTGCCTCCGGGTCGGGGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 200} {0: 1, 1: 0, 2: 0, 3: 14, 4: 149}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!