ID: 931748552_931748567

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 931748552 931748567
Species Human (GRCh38) Human (GRCh38)
Location 2:65311535-65311557 2:65311579-65311601
Sequence CCTAGAGAAAGACCCCAAGGAAG TGGTCTCTCGACAGCACTGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 285} {0: 1, 1: 0, 2: 0, 3: 10, 4: 90}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!