ID: 931755615_931755616

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 931755615 931755616
Species Human (GRCh38) Human (GRCh38)
Location 2:65371568-65371590 2:65371619-65371641
Sequence CCTTCAGTACACACAGTGACAAA CTATGTTTCTTAAAGTGTAACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 229} {0: 1, 1: 0, 2: 3, 3: 15, 4: 232}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!