ID: 931757807_931757818

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 931757807 931757818
Species Human (GRCh38) Human (GRCh38)
Location 2:65389373-65389395 2:65389390-65389412
Sequence CCTCTTACCCCTGAAGGGTGTGT GTGTGTTGGGGGAGGAAGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 108} {0: 1, 1: 5, 2: 14, 3: 194, 4: 1744}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!