ID: 931761400_931761405

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 931761400 931761405
Species Human (GRCh38) Human (GRCh38)
Location 2:65420307-65420329 2:65420342-65420364
Sequence CCTCCGTGTTGGAGTTATTGACA GTATTTTTAGTACCCCTTTTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 90} {0: 1, 1: 0, 2: 0, 3: 22, 4: 187}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!