ID: 931853942_931853950

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 931853942 931853950
Species Human (GRCh38) Human (GRCh38)
Location 2:66281978-66282000 2:66282028-66282050
Sequence CCCTAGTTCAGGTTCTGATCAGT TTTACTGTCCTTCCTCCTCTAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!