ID: 931973454_931973461 |
View in Genome Browser |
Spacer: 5 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 931973454 | 931973461 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 2:67616146-67616168 | 2:67616174-67616196 |
| Sequence | CCACGTTGACTTCCAGAGCCACA | CTGGGAACTCAGAAGGAACTAGG |
| Strand | - | + |
| Off-target summary | No data | No data |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||