ID: 932052496_932052502

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 932052496 932052502
Species Human (GRCh38) Human (GRCh38)
Location 2:68412693-68412715 2:68412723-68412745
Sequence CCCTCTGCTCTCCTTCACTACAG GGCCTCTTGTTGGTCCTTGGAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 4, 4: 152}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!