ID: 932067629_932067633

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 932067629 932067633
Species Human (GRCh38) Human (GRCh38)
Location 2:68583265-68583287 2:68583288-68583310
Sequence CCCTGCAACAGCTTTACTACCCT ATTTATCTTCTCCCCTTAACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 90} {0: 1, 1: 0, 2: 3, 3: 65, 4: 1103}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!