ID: 932097444_932097449

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 932097444 932097449
Species Human (GRCh38) Human (GRCh38)
Location 2:68864088-68864110 2:68864115-68864137
Sequence CCACCGGACCCTTCCTGTGCAGA TTCCTCACCACTTTCAGTCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 10, 3: 60, 4: 231} {0: 1, 1: 0, 2: 2, 3: 17, 4: 186}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!