ID: 932165057_932165067

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 932165057 932165067
Species Human (GRCh38) Human (GRCh38)
Location 2:69498354-69498376 2:69498402-69498424
Sequence CCTGTCTCTGAATCTTGGTCTCT AGGATGCTCTGGGGTCTACTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 39, 4: 438} {0: 1, 1: 0, 2: 0, 3: 33, 4: 272}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!