|
Left Crispr |
Right Crispr |
| Crispr ID |
932183990 |
932183997 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
2:69675847-69675869
|
2:69675889-69675911
|
| Sequence |
CCCTGTCTCTACTAAAAATACAA |
CTCAGATTCTCGGGAGGTTGAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 62759, 1: 158911, 2: 184886, 3: 115845, 4: 74212} |
{0: 1, 1: 4, 2: 267, 3: 9850, 4: 140912} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|