ID: 932188097_932188104

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 932188097 932188104
Species Human (GRCh38) Human (GRCh38)
Location 2:69715724-69715746 2:69715750-69715772
Sequence CCAAAATGTGTTTTGTCCCCTTC GCCTATGCACAGAGGGCAGTGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 43, 4: 724} {0: 2, 1: 0, 2: 1, 3: 23, 4: 175}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!