ID: 932195524_932195534

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 932195524 932195534
Species Human (GRCh38) Human (GRCh38)
Location 2:69779914-69779936 2:69779929-69779951
Sequence CCCTTAGTTGAACCCCCAGGTAA CCAGGTAATAGGGGGTAAGTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 50} {0: 1, 1: 0, 2: 1, 3: 8, 4: 106}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!