ID: 932245179_932245184

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 932245179 932245184
Species Human (GRCh38) Human (GRCh38)
Location 2:70190783-70190805 2:70190801-70190823
Sequence CCGGTCCCAAGTAGGCCCAGGCA AGGCAGAAGCATCACCTCGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 147} {0: 1, 1: 0, 2: 2, 3: 14, 4: 190}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!