ID: 932246316_932246322

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 932246316 932246322
Species Human (GRCh38) Human (GRCh38)
Location 2:70199663-70199685 2:70199683-70199705
Sequence CCCTCATGTGTCCCACCTGCAGC AGCTGCCTCCAAGGCAGCTTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 299} {0: 1, 1: 0, 2: 2, 3: 23, 4: 181}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!