ID: 932257729_932257743

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 932257729 932257743
Species Human (GRCh38) Human (GRCh38)
Location 2:70301797-70301819 2:70301837-70301859
Sequence CCCCAGGGCCGCCCACACCCGGT CAGTGCAAGGCGTCGCGTGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 177} {0: 1, 1: 0, 2: 1, 3: 3, 4: 63}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!