ID: 932266374_932266385

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 932266374 932266385
Species Human (GRCh38) Human (GRCh38)
Location 2:70370706-70370728 2:70370753-70370775
Sequence CCCATCTGAGAGGCAGTAAGTCA CCTCATCTGTAGAGTGAGGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 142} {0: 1, 1: 2, 2: 20, 3: 152, 4: 649}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!