ID: 932280203_932280206

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 932280203 932280206
Species Human (GRCh38) Human (GRCh38)
Location 2:70484832-70484854 2:70484883-70484905
Sequence CCAACAAAGTTGCTTTTGTTCAA AGAACCCTAGTTGATGTATTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 16, 4: 260} {0: 1, 1: 0, 2: 1, 3: 7, 4: 96}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!