ID: 932280945_932280949

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 932280945 932280949
Species Human (GRCh38) Human (GRCh38)
Location 2:70491384-70491406 2:70491417-70491439
Sequence CCCAAACCAAAGTTTTCAGCTTG GAAGTCATCCATACCACACCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 210} {0: 1, 1: 0, 2: 0, 3: 8, 4: 93}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!