ID: 932300567_932300570

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 932300567 932300570
Species Human (GRCh38) Human (GRCh38)
Location 2:70664029-70664051 2:70664070-70664092
Sequence CCAGCTCAGAGTTTTTCTAGGCA CAGAGAAAGGAGAAGGCGTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 156} {0: 1, 1: 0, 2: 5, 3: 63, 4: 662}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!