ID: 932308508_932308514

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 932308508 932308514
Species Human (GRCh38) Human (GRCh38)
Location 2:70720879-70720901 2:70720899-70720921
Sequence CCTTCTCCACTCCCTTTCTCCTC CTCCCTTGCCTCCCTGCTGGAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 26, 3: 271, 4: 2241} {0: 1, 1: 0, 2: 0, 3: 48, 4: 418}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!