ID: 932313836_932313853

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 932313836 932313853
Species Human (GRCh38) Human (GRCh38)
Location 2:70767160-70767182 2:70767198-70767220
Sequence CCTCCGGGACCGGGGATGGCCTC AAGGGAGGGGAGGCAGGGAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 102} {0: 1, 1: 9, 2: 83, 3: 791, 4: 4840}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!