ID: 932313848_932313857

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 932313848 932313857
Species Human (GRCh38) Human (GRCh38)
Location 2:70767186-70767208 2:70767225-70767247
Sequence CCCGGCTGCAGAAAGGGAGGGGA GGAAGATGGAAGAAACAGACTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 6, 3: 65, 4: 480} {0: 1, 1: 0, 2: 4, 3: 57, 4: 630}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!