|
Left Crispr |
Right Crispr |
| Crispr ID |
932313849 |
932313855 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
2:70767187-70767209
|
2:70767204-70767226
|
| Sequence |
CCGGCTGCAGAAAGGGAGGGGAG |
GGGGAGGCAGGGAGAGGAGAGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 0, 2: 2, 3: 39, 4: 469} |
{0: 2, 1: 4, 2: 91, 3: 801, 4: 5694} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|