ID: 932314812_932314818

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 932314812 932314818
Species Human (GRCh38) Human (GRCh38)
Location 2:70772908-70772930 2:70772953-70772975
Sequence CCAGACCTGGAGAGCTGTGGATA ATAACATGTAAGTCCCTCTGGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 8, 4: 88}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!