ID: 932337973_932337982

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 932337973 932337982
Species Human (GRCh38) Human (GRCh38)
Location 2:70941900-70941922 2:70941930-70941952
Sequence CCATCGGAGGCCACTGAAGCCAG AAGGCCAAGGAGAGGGTGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 153} {0: 1, 1: 0, 2: 4, 3: 67, 4: 836}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!