ID: 932340346_932340354

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 932340346 932340354
Species Human (GRCh38) Human (GRCh38)
Location 2:70959427-70959449 2:70959448-70959470
Sequence CCCTATCCCATCTGTTTACTGAG AGGACACACTGGGAGGCCTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 14, 4: 175} {0: 1, 1: 1, 2: 4, 3: 42, 4: 402}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!