ID: 932340491_932340494

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 932340491 932340494
Species Human (GRCh38) Human (GRCh38)
Location 2:70960198-70960220 2:70960214-70960236
Sequence CCAGCATCGAGACTGGCAGCTGT CAGCTGTCCCTGGGCAGCTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 120} {0: 1, 1: 2, 2: 4, 3: 52, 4: 411}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!