ID: 932341534_932341541

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 932341534 932341541
Species Human (GRCh38) Human (GRCh38)
Location 2:70965309-70965331 2:70965322-70965344
Sequence CCCCCTCGACTCCCGGTGCTGCG CGGTGCTGCGGAAGAACTGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 66} {0: 1, 1: 0, 2: 0, 3: 6, 4: 92}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!