ID: 932353780_932353790

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 932353780 932353790
Species Human (GRCh38) Human (GRCh38)
Location 2:71051845-71051867 2:71051886-71051908
Sequence CCCCTCTCCCTCTGGATATAAGG TGTGCACCCGCTGCGATATTGGG
Strand - +
Off-target summary {0: 3, 1: 17, 2: 77, 3: 310, 4: 863} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!