ID: 932356451_932356455

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 932356451 932356455
Species Human (GRCh38) Human (GRCh38)
Location 2:71071944-71071966 2:71071975-71071997
Sequence CCTCAACTCTTTAAGTAGTTTAA CAGAGCAAGGACCAGGCAGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 300} {0: 1, 1: 0, 2: 4, 3: 64, 4: 410}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!