ID: 932412489_932412501

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 932412489 932412501
Species Human (GRCh38) Human (GRCh38)
Location 2:71555556-71555578 2:71555603-71555625
Sequence CCTCATTGGGTGGTAGAATCTGG GAACCAGAGCAGGCTCGGAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 93} {0: 1, 1: 0, 2: 1, 3: 23, 4: 250}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!