ID: 932414262_932414269

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 932414262 932414269
Species Human (GRCh38) Human (GRCh38)
Location 2:71564380-71564402 2:71564393-71564415
Sequence CCCCCGAAGTCCCCAGGCCCCTG CAGGCCCCTGCACCTAGTCTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 30, 4: 307} {0: 1, 1: 0, 2: 1, 3: 28, 4: 272}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!