ID: 932414438_932414446

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 932414438 932414446
Species Human (GRCh38) Human (GRCh38)
Location 2:71565149-71565171 2:71565193-71565215
Sequence CCACTCACTGCAGCCTCCGCCTC CCCTCAGCCTCCTGAGTAGCTGG
Strand - +
Off-target summary {0: 66, 1: 1270, 2: 5263, 3: 5630, 4: 3505} {0: 1034, 1: 101354, 2: 208048, 3: 241971, 4: 153021}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!