|
Left Crispr |
Right Crispr |
Crispr ID |
932414438 |
932414446 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
2:71565149-71565171
|
2:71565193-71565215
|
Sequence |
CCACTCACTGCAGCCTCCGCCTC |
CCCTCAGCCTCCTGAGTAGCTGG |
Strand |
- |
+ |
Off-target summary |
{0: 66, 1: 1270, 2: 5263, 3: 5630, 4: 3505} |
{0: 1034, 1: 101354, 2: 208048, 3: 241971, 4: 153021} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|