ID: 932416018_932416029

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 932416018 932416029
Species Human (GRCh38) Human (GRCh38)
Location 2:71574355-71574377 2:71574385-71574407
Sequence CCCTTGAGGGGGCCCTGGTATGT CACTTGTCCTGGCTTGGGTAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 93} {0: 1, 1: 0, 2: 1, 3: 14, 4: 136}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!