ID: 932431098_932431107

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 932431098 932431107
Species Human (GRCh38) Human (GRCh38)
Location 2:71674042-71674064 2:71674064-71674086
Sequence CCTTCCCAGTCTTCCCACAGGAC CCTGGCTCTGGCAGGTCCCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 36, 4: 335} {0: 1, 1: 0, 2: 5, 3: 43, 4: 332}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!