ID: 932431098_932431113

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 932431098 932431113
Species Human (GRCh38) Human (GRCh38)
Location 2:71674042-71674064 2:71674093-71674115
Sequence CCTTCCCAGTCTTCCCACAGGAC CCTACTCCTCTGCCTCCTCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 36, 4: 335} {0: 1, 1: 2, 2: 7, 3: 162, 4: 857}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!