ID: 932439257_932439262

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 932439257 932439262
Species Human (GRCh38) Human (GRCh38)
Location 2:71721496-71721518 2:71721518-71721540
Sequence CCAAAATAACTCAGCTCTCCCAA ACCCCAGGCATTCCCAGGACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 155} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!