ID: 932439263_932439269

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 932439263 932439269
Species Human (GRCh38) Human (GRCh38)
Location 2:71721519-71721541 2:71721547-71721569
Sequence CCCCAGGCATTCCCAGGACTGGA ACACTCCTTCTCTTTCCCTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 51, 4: 459} {0: 1, 1: 0, 2: 6, 3: 42, 4: 384}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!