ID: 932493413_932493419

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 932493413 932493419
Species Human (GRCh38) Human (GRCh38)
Location 2:72135080-72135102 2:72135107-72135129
Sequence CCACCCCCAGAGAGGGGGCTCAT GCCCCTGCTCCTCTCCTCCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 209} {0: 1, 1: 0, 2: 13, 3: 90, 4: 757}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!