ID: 932493615_932493625

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 932493615 932493625
Species Human (GRCh38) Human (GRCh38)
Location 2:72136079-72136101 2:72136098-72136120
Sequence CCCCCCTTGCCACCCTCCTCACC CACCCAGGACTCCCCCGCACAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 8, 3: 130, 4: 1138} {0: 1, 1: 0, 2: 0, 3: 19, 4: 161}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!