ID: 932502074_932502076

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 932502074 932502076
Species Human (GRCh38) Human (GRCh38)
Location 2:72191819-72191841 2:72191842-72191864
Sequence CCAGCAGCAAGTCTAGAAATAAT TCAGATGGATGAGTTGCTCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 160} {0: 1, 1: 0, 2: 1, 3: 20, 4: 196}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!