ID: 932503166_932503176

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 932503166 932503176
Species Human (GRCh38) Human (GRCh38)
Location 2:72202835-72202857 2:72202874-72202896
Sequence CCTGTCCCCTTTATGGATTTCAC TGAGCCGGGGACAGAGGGTAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 111} {0: 1, 1: 0, 2: 1, 3: 32, 4: 268}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!