ID: 932570472_932570475

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 932570472 932570475
Species Human (GRCh38) Human (GRCh38)
Location 2:72935821-72935843 2:72935843-72935865
Sequence CCTCCATGTTGCAGCTAGGTTTC CTCTTCCTTGCACCCAAACAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 109} {0: 1, 1: 0, 2: 0, 3: 16, 4: 218}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!