ID: 932572473_932572477

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 932572473 932572477
Species Human (GRCh38) Human (GRCh38)
Location 2:72945309-72945331 2:72945327-72945349
Sequence CCAGACCAGATCTCTTTCTTCTG TTCTGATGGTGTGTCCACGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 32, 4: 371} {0: 1, 1: 0, 2: 2, 3: 9, 4: 102}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!