ID: 932573563_932573567

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 932573563 932573567
Species Human (GRCh38) Human (GRCh38)
Location 2:72950846-72950868 2:72950862-72950884
Sequence CCACAGACTGGCTCTGAGGGGCC AGGGGCCTTCTCCGGGGATAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 302} {0: 1, 1: 0, 2: 0, 3: 4, 4: 92}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!